Expressing:
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. To construct pAc5.1- DmCRY- V5- APEX2, the APEX2 coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos; 5′ TGACGCGTGGAAAGTCTTACCCAACTGTG 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with MluI- SacI restriction enzymes, and then cloned into MluI- SacI site of pAc5.1DmCRY- V5His, which was previously described.45 To construct pAc5.1- V5- APEX2, V5- APEX2 was amplified from pAc5.1- DmCRY- V5- APEX2 using the oligos; 5′ A AAC TCG AGT TGC CAC CAT GGG TAA GCC TATCCCTAAC 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with XhoI, and cloned into XhoI- PmeI site of pAc5.1/V5HisA plasmid (Thermofisher Scientific, cat no: V411020). .. To construct pAc.5.1- 3xHATurboID- V5His, 3xHA- TurboID- NLS_pCDNA3 (Addgene Plasmid #107171) was digested with NotI, filled to get blunt ends, and then digested with EcoRI.
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. For this, 3xFLAG coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos 5′ ATCGAATTCGCCACCATGGACTACAAAGACC 3′ and 5′ CTGGCTAGCCTTGTCATCGTCATCCT 3′ and cloned into EcoRI- NheI site of pFast- FLAG- His- DmCRY. pAc5.1- V5- JET and pAc5.1- TIM- V5HisA constructs were previously described.24,29 pAc5.1- TIM- V5HisA construct encodes the shorter (by 23 N- terminal amino acids) and more light- sensitive form of Tim (called s- Tim).26 To construct pAc5.1- 3xHA- V5, the 3xHA coding sequence was initially amplified from 3xHA- MiniTurbo- NLSpcDNA3 (Addgene Plasmid #107172) using the oligos 5′ TAGACCGGTATGTACCCGTAT 3′ and 5′ C ATG AGC TCT CAT GCG TAG TCT GGG ACG TCA TAG GGA TACCCGGCATAGT 3′, digested with AgeI- SacI, and inserted into AgeI- SacI site of pAc5.1/V5HisA plasmid. ..
Article Title: Proteomic Insights into Circadian Transcription Regulation: Novel E-box Interactors Revealed by Proximity Labeling
Article Snippet: .. The inducible CASPEX expression plasmid (Addgene #97421) was stably transfected into Dbp(luc) array NIH3T3 cells using LipofectamineTM 3000 from Invitrogen. ..
Polymerase Chain Reaction:
Plasmid Preparation:
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. To construct pAc5.1- DmCRY- V5- APEX2, the APEX2 coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos; 5′ TGACGCGTGGAAAGTCTTACCCAACTGTG 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with MluI- SacI restriction enzymes, and then cloned into MluI- SacI site of pAc5.1DmCRY- V5His, which was previously described.45 To construct pAc5.1- V5- APEX2, V5- APEX2 was amplified from pAc5.1- DmCRY- V5- APEX2 using the oligos; 5′ A AAC TCG AGT TGC CAC CAT GGG TAA GCC TATCCCTAAC 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with XhoI, and cloned into XhoI- PmeI site of pAc5.1/V5HisA plasmid (Thermofisher Scientific, cat no: V411020). .. To construct pAc.5.1- 3xHATurboID- V5His, 3xHA- TurboID- NLS_pCDNA3 (Addgene Plasmid #107171) was digested with NotI, filled to get blunt ends, and then digested with EcoRI.
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. For this, 3xFLAG coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos 5′ ATCGAATTCGCCACCATGGACTACAAAGACC 3′ and 5′ CTGGCTAGCCTTGTCATCGTCATCCT 3′ and cloned into EcoRI- NheI site of pFast- FLAG- His- DmCRY. pAc5.1- V5- JET and pAc5.1- TIM- V5HisA constructs were previously described.24,29 pAc5.1- TIM- V5HisA construct encodes the shorter (by 23 N- terminal amino acids) and more light- sensitive form of Tim (called s- Tim).26 To construct pAc5.1- 3xHA- V5, the 3xHA coding sequence was initially amplified from 3xHA- MiniTurbo- NLSpcDNA3 (Addgene Plasmid #107172) using the oligos 5′ TAGACCGGTATGTACCCGTAT 3′ and 5′ C ATG AGC TCT CAT GCG TAG TCT GGG ACG TCA TAG GGA TACCCGGCATAGT 3′, digested with AgeI- SacI, and inserted into AgeI- SacI site of pAc5.1/V5HisA plasmid. ..
Article Title: Proteomic Insights into Circadian Transcription Regulation: Novel E-box Interactors Revealed by Proximity Labeling
Article Snippet: .. The inducible CASPEX expression plasmid (Addgene #97421) was stably transfected into Dbp(luc) array NIH3T3 cells using LipofectamineTM 3000 from Invitrogen. ..
Construct:Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. To construct pAc5.1- DmCRY- V5- APEX2, the APEX2 coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos; 5′ TGACGCGTGGAAAGTCTTACCCAACTGTG 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with MluI- SacI restriction enzymes, and then cloned into MluI- SacI site of pAc5.1DmCRY- V5His, which was previously described.45 To construct pAc5.1- V5- APEX2, V5- APEX2 was amplified from pAc5.1- DmCRY- V5- APEX2 using the oligos; 5′ A AAC TCG AGT TGC CAC CAT GGG TAA GCC TATCCCTAAC 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with XhoI, and cloned into XhoI- PmeI site of pAc5.1/V5HisA plasmid (Thermofisher Scientific, cat no: V411020). .. To construct pAc.5.1- 3xHATurboID- V5His, 3xHA- TurboID- NLS_pCDNA3 (Addgene Plasmid #107171) was digested with NotI, filled to get blunt ends, and then digested with EcoRI.
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. For this, 3xFLAG coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos 5′ ATCGAATTCGCCACCATGGACTACAAAGACC 3′ and 5′ CTGGCTAGCCTTGTCATCGTCATCCT 3′ and cloned into EcoRI- NheI site of pFast- FLAG- His- DmCRY. pAc5.1- V5- JET and pAc5.1- TIM- V5HisA constructs were previously described.24,29 pAc5.1- TIM- V5HisA construct encodes the shorter (by 23 N- terminal amino acids) and more light- sensitive form of Tim (called s- Tim).26 To construct pAc5.1- 3xHA- V5, the 3xHA coding sequence was initially amplified from 3xHA- MiniTurbo- NLSpcDNA3 (Addgene Plasmid #107172) using the oligos 5′ TAGACCGGTATGTACCCGTAT 3′ and 5′ C ATG AGC TCT CAT GCG TAG TCT GGG ACG TCA TAG GGA TACCCGGCATAGT 3′, digested with AgeI- SacI, and inserted into AgeI- SacI site of pAc5.1/V5HisA plasmid. ..
Sequencing:Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. To construct pAc5.1- DmCRY- V5- APEX2, the APEX2 coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos; 5′ TGACGCGTGGAAAGTCTTACCCAACTGTG 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with MluI- SacI restriction enzymes, and then cloned into MluI- SacI site of pAc5.1DmCRY- V5His, which was previously described.45 To construct pAc5.1- V5- APEX2, V5- APEX2 was amplified from pAc5.1- DmCRY- V5- APEX2 using the oligos; 5′ A AAC TCG AGT TGC CAC CAT GGG TAA GCC TATCCCTAAC 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with XhoI, and cloned into XhoI- PmeI site of pAc5.1/V5HisA plasmid (Thermofisher Scientific, cat no: V411020). .. To construct pAc.5.1- 3xHATurboID- V5His, 3xHA- TurboID- NLS_pCDNA3 (Addgene Plasmid #107171) was digested with NotI, filled to get blunt ends, and then digested with EcoRI.
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. For this, 3xFLAG coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos 5′ ATCGAATTCGCCACCATGGACTACAAAGACC 3′ and 5′ CTGGCTAGCCTTGTCATCGTCATCCT 3′ and cloned into EcoRI- NheI site of pFast- FLAG- His- DmCRY. pAc5.1- V5- JET and pAc5.1- TIM- V5HisA constructs were previously described.24,29 pAc5.1- TIM- V5HisA construct encodes the shorter (by 23 N- terminal amino acids) and more light- sensitive form of Tim (called s- Tim).26 To construct pAc5.1- 3xHA- V5, the 3xHA coding sequence was initially amplified from 3xHA- MiniTurbo- NLSpcDNA3 (Addgene Plasmid #107172) using the oligos 5′ TAGACCGGTATGTACCCGTAT 3′ and 5′ C ATG AGC TCT CAT GCG TAG TCT GGG ACG TCA TAG GGA TACCCGGCATAGT 3′, digested with AgeI- SacI, and inserted into AgeI- SacI site of pAc5.1/V5HisA plasmid. ..
Amplification:Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. To construct pAc5.1- DmCRY- V5- APEX2, the APEX2 coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos; 5′ TGACGCGTGGAAAGTCTTACCCAACTGTG 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with MluI- SacI restriction enzymes, and then cloned into MluI- SacI site of pAc5.1DmCRY- V5His, which was previously described.45 To construct pAc5.1- V5- APEX2, V5- APEX2 was amplified from pAc5.1- DmCRY- V5- APEX2 using the oligos; 5′ A AAC TCG AGT TGC CAC CAT GGG TAA GCC TATCCCTAAC 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with XhoI, and cloned into XhoI- PmeI site of pAc5.1/V5HisA plasmid (Thermofisher Scientific, cat no: V411020). .. To construct pAc.5.1- 3xHATurboID- V5His, 3xHA- TurboID- NLS_pCDNA3 (Addgene Plasmid #107171) was digested with NotI, filled to get blunt ends, and then digested with EcoRI.
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. For this, 3xFLAG coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos 5′ ATCGAATTCGCCACCATGGACTACAAAGACC 3′ and 5′ CTGGCTAGCCTTGTCATCGTCATCCT 3′ and cloned into EcoRI- NheI site of pFast- FLAG- His- DmCRY. pAc5.1- V5- JET and pAc5.1- TIM- V5HisA constructs were previously described.24,29 pAc5.1- TIM- V5HisA construct encodes the shorter (by 23 N- terminal amino acids) and more light- sensitive form of Tim (called s- Tim).26 To construct pAc5.1- 3xHA- V5, the 3xHA coding sequence was initially amplified from 3xHA- MiniTurbo- NLSpcDNA3 (Addgene Plasmid #107172) using the oligos 5′ TAGACCGGTATGTACCCGTAT 3′ and 5′ C ATG AGC TCT CAT GCG TAG TCT GGG ACG TCA TAG GGA TACCCGGCATAGT 3′, digested with AgeI- SacI, and inserted into AgeI- SacI site of pAc5.1/V5HisA plasmid. ..
Clone Assay:Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. To construct pAc5.1- DmCRY- V5- APEX2, the APEX2 coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos; 5′ TGACGCGTGGAAAGTCTTACCCAACTGTG 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with MluI- SacI restriction enzymes, and then cloned into MluI- SacI site of pAc5.1DmCRY- V5His, which was previously described.45 To construct pAc5.1- V5- APEX2, V5- APEX2 was amplified from pAc5.1- DmCRY- V5- APEX2 using the oligos; 5′ A AAC TCG AGT TGC CAC CAT GGG TAA GCC TATCCCTAAC 3′ and 5′ G CTG AGC TCT TAG TTT AAA CTC GGC ATC AGCAAACCCAA 3′, digested with XhoI, and cloned into XhoI- PmeI site of pAc5.1/V5HisA plasmid (Thermofisher Scientific, cat no: V411020). .. To construct pAc.5.1- 3xHATurboID- V5His, 3xHA- TurboID- NLS_pCDNA3 (Addgene Plasmid #107171) was digested with NotI, filled to get blunt ends, and then digested with EcoRI.
Article Title: Interactions of drosophila cryptochrome.
Article Snippet: .. For this, 3xFLAG coding sequence was amplified from Inducible Caspex expression plasmid (Addgene Plasmid #97421) using the oligos 5′ ATCGAATTCGCCACCATGGACTACAAAGACC 3′ and 5′ CTGGCTAGCCTTGTCATCGTCATCCT 3′ and cloned into EcoRI- NheI site of pFast- FLAG- His- DmCRY. pAc5.1- V5- JET and pAc5.1- TIM- V5HisA constructs were previously described.24,29 pAc5.1- TIM- V5HisA construct encodes the shorter (by 23 N- terminal amino acids) and more light- sensitive form of Tim (called s- Tim).26 To construct pAc5.1- 3xHA- V5, the 3xHA coding sequence was initially amplified from 3xHA- MiniTurbo- NLSpcDNA3 (Addgene Plasmid #107172) using the oligos 5′ TAGACCGGTATGTACCCGTAT 3′ and 5′ C ATG AGC TCT CAT GCG TAG TCT GGG ACG TCA TAG GGA TACCCGGCATAGT 3′, digested with AgeI- SacI, and inserted into AgeI- SacI site of pAc5.1/V5HisA plasmid. ..
Stable Transfection:Article Title: Proteomic Insights into Circadian Transcription Regulation: Novel E-box Interactors Revealed by Proximity Labeling
Article Snippet: .. The inducible CASPEX expression plasmid (Addgene #97421) was stably transfected into Dbp(luc) array NIH3T3 cells using LipofectamineTM 3000 from Invitrogen. ..
Transfection:Article Title: Proteomic Insights into Circadian Transcription Regulation: Novel E-box Interactors Revealed by Proximity Labeling
Article Snippet: .. The inducible CASPEX expression plasmid (Addgene #97421) was stably transfected into Dbp(luc) array NIH3T3 cells using LipofectamineTM 3000 from Invitrogen. ..
|
Addgene inc is a verified supplier 